Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Why do poor countries have a predominance of infectious

Why do poor countries have a predominance of infectious diseases as opposed to the lifestyle-related diseases of wealthy countries? What is your response to the global health inequalities that exist? By Marcela Step One: Why do poor countries have a predominance of Infectious diseases as opposed to the lifestyle-related diseases of wealthy countries? What Is your response to the global health Inequalities that exist? Step Two: Willie's sociological imagination template has made me understand how factors including historical, cultural, structural and critical components affect the way one fives their life (Willis, as cited in Germen, 2014).As each factor is linked to one another, a variance of health issues worldwide continuously exists. I have experienced global health inequality first hand due to structural factors such as undeveloped technology and education. During the semester break of this year, I was fortunate enough to travel throughout South America. Unfortunately whilst trav eling I became very ill and was taken to a clinic for medical assistance. One attended to, patients, including myself were treated in an unhygienic environment, with poor attention to sanitation such as clean sheets on the examination bed.Poor health practices also occurred with very few health professionals wearing appropriate clothing such as gloves when vaccinating a patient or correctively washing their hands before and after examining a patient. Personally, the experience of being treated with such medical attendance under poor conditions has led me to believe that the predominance of infectious diseases in developing nations Is somewhat because health practices are not being followed In accordance to clinical practice guidelines.Marcela Merles S00107898 using my experience as an example, the environment Itself and the negligence of hygiene from health professionals themselves creates an easy exposure and outbreak of Infectious diseases to patients. Both examples are easily pre ventable and the health Inequality here exists when comparing the treatment given to patients using health standards of developed nations In comparison to undeveloped nations. On another hand, I have seen the predominance of lifestyle-related diseases In Australia from a cultural component.Born and raised in Australia I know that the Australian culture consists of social gatherings such as barbeques, which increase the likelihood of choices such as alcohol consumption, smoking and unhealthy diet. Ordinance of diseases in wealthy nations such as Australia are due to lifestyle choices made by the individual. The individual is putting themselves at risk with behaviors such as lack of exercise and unhealthy dieting contributing to obesity and cardiovascular diseases.In comparison, I believe the predominance of diseases in underdeveloped nations is primarily infectious-based due to the quality of care received by patients. A large percentage of citizens have difficulty accessing health c are of greater-quality because of their socio-economic status or the unavailability of such health care found within reasonable traveling distance. I believe health inequalities are preventable, but barriers as those mentioned previously including a lack of education from health professionals as well, obstructs any preventative measures from being put into action, exposing patients to a greater risk of diseases.Manila Merles s00107898 Step Three: Further research into health sociology, in particular the sociological theory of modernity (Lives, 2008), has given me greater awareness of how and why particular health problems exist. Lives (2008) defines modernity as a modern outlook of the world driven by economy, politics and science. Breakthrough in these areas has not only shown structural changes to the development of industrialization and political democracy, but also a changed way of thinking with modernization of knowledge and ideas.Modernization represents a complete change from the past out breaking into a different type of society. The theory of modernity can be linked to the structural factors of the sociological template and has shown me an understanding of how modern societies have an advantage in social organizations, in comparison to undeveloped societies. This concept is strongly influenced by technology and such advancements in wealthy countries allow citizens to live differently to those in undeveloped nations.In respect to health, advanced technology may include medical treatment including resources used that are of higher quality than those used in undeveloped nations. Likewise, modernity allows for advancements in education and in reference to health inequality, health education must be put into further action for undeveloped societies to be taught at least the basic forms of prevention of diseases. An insight into the theory of modernity has shown me that everyone sees health and illness fervently and hence is a reason why there are health di fferences among cultures and countries worldwide.As the structural components of a social organization affect people's lives, it is important to look at the role the government of undeveloped nations play within their health care system. Using my personal experience as recalled in part two, citizens in South America do not have control over the health care they receive. In Australia, we are fortunate to have Medicare as the basis of Australia's health care system, covering many health care costs for its citizens. Such health care system does not exist in South America, therefore the financial status of each individual impact greatly receive care and treatment at all.Additionally, economic disadvantages within a nation may not have substantial funds to build health care centers such as hospitals and medical centers or provide those in need with medical supplies that are economically in reach. I believe that Australia has developed chronic lifestyle-related diseases due to behaviors s uch as eating patterns while South America has developed infectious diseases through unhygienic practices. Furthermore, I used the social model of health as a reference to make rather understanding of health inequality and possible methods for providing better health for those in need (Germen, 2014).This model highlights â€Å"health inequalities suffered by different social groups based on class, gender, ethnicity and occupation† (Germen, 2014). Having this in mind, I can make reference to the Australian lifestyle and culture as a determinant for chronic diseases suffered in this country. Manila Merles s0010789 I believe that Australia has developed chronic lifestyle-related diseases due to behaviors such as eating patterns while South America has developed infectious sissies through unhygienic practices.In addiction to unhygienic practices as a factor of infectious diseases, the social model of health has made me understand that education; economic status, ethnicity and acc ess to health care systems also contribute to this as well. Step Four: The World Health Organization (2014) has defined health inequality as â€Å"differences in health status or in the distribution of health determinants between different population groups†. The social, economic and environmental conditions in which a person is born and lives in strongly influences one's health (WHO, 2014).Health inequalities can be due to natural variations or personal choices, I. E. The growth of lifestyle-related diseases in Australia, and others are due to outside environment and conditions the individual cannot control, I. E. The predominance of infectious diseases in poor countries (Turrets, Stately, De Eloper, & Oldenburg, 2006). The uneven distribution of health inequality worldwide is unjust and unfair but such unfairness is not only found within the distribution of health itself (Irradiate and Allotted, 2007).This has created a significant gap of health status between the wealthy a nd the poor. Not only are health inequalities apparent between different socio-economic groups but also between genders and different ethnic groups (Allotted, Irradiate, Kumar, & Cummins, 2003). To begin with, Irradiate and Allotted (2007) have researched health inequality as an outcome of economically deprived populations. Differences in population health are associated with global health outcomes (Irradiate and Allotted, 2007).Health inequality due to economy is unfair as the difficulty a population experiences in health care is determined by the population's wealth (Irradiate and Allotted, 2007). Poorer countries have shown to be affected by an uneven distribution of health of up to five times worse off than the standard of health experienced in wealthier countries (Irradiate and Allotted, 2007). It has been shown that wealthier countries have higher capacity to support poor health than in poor countries, with the impact of poor health on an individual and societal level being si gnificantly less (Allotted et al. 2003). Reasons for this include the investment in social and healthcare services and higher-quality physical infrastructure found within wealthier regions, controlling the impact of death and illness (Allotted et al. , 2003). Likewise, new scientific discoveries such as the vaccine against the human papilla virus preventing cervical cancer offers advanced and improved health. However an individual's economic status remains an obstacle to ensure the availability of such vaccination to those most at risk (Senator, Gill, & Beaker, 2011).Alkali and Chin (2004) have also concluded that socioeconomics disadvantaged groups experience greater ill health, as they are likely to put themselves at risk engaging in behaviors that are linked with poorer health status. In this case, such groups are also less likely to act on improving their health as well (Alkali and Chin, 2004). Additionally, powers that have the ability to effectively sustain caring social servi ces, including health care systems to citizens of each country also shapes population health (Turrets et al. , 2006).This may not be the case in poorer countries as the nation's government may lack governmental institutions such as Medicare available in Australia, covering many health care costs, making it possible for citizens to receive medical treatment when in need. Extra alternatives such as private health insurance are also available in Australia but such service may be unavailable in poorer countries or financially inaccessible to the individual. Also, over half of the population in developing nations do not have access to medicines for the treatment of diseases such as cholera, malaria or typhoid fever (Gelid, 2005).Lack of access to basic medicine supplies such as antibiotics, decongestants or analgesic also expose people as being vulnerable to infectious diseases (Gelid, 2005). Secondly, population health has also been shaped according to educational level Turrets, Stanley , De Eloper, & Oldenburg, 2006). Cutler and Leers-Money (2012) conclude that education is key to ending bad health habits and a crucial factor that contributes to the transmission of infectious diseases. According to Denton (2003) wealthier, well-educated populations live longer than poorer, less-educated populations.An educated person is said to have a higher capacity to understand and apply health benefits for themselves as well as have greater access to health care Reflecting back on my personal experience, some health professionals may lack impotency to follow clinical practice guidelines of the same standard followed by health professionals in Australia. Health professionals in undeveloped nations may not realism the importance of following such guidelines or may not be put into action as strictly as they are in Australia.In Australia clinical practice guidelines state the extent of clean and highly sanitation service that must be provided to the patient. The lack of education and knowledge to do so including following procedures such as hand washing puts the health professional primarily at fault for the spread of infectious diseases from patient to patient. Likewise, not only health professionals but also citizens of underdeveloped nations do not have substantial access to education, therefore it is difficult for knowledge of good health to be practiced. Developing countries are also lacking in promotion of good health as well (Senator, Gill, & Beaker, 2011).Education will also end poverty through employment and develop skills that help improve health status in underdeveloped nations (Cutler and Leers- Money, 2012). Additionally, poor nutrition also contributes increases unhealthy lifestyles. Those who are at a financial disadvantage do not have access to essential nutrients. Lack of clean water in undeveloped nations also increases the spread of infectious diseases. Those who do not have access to fresh, uncontaminated water have no choice but to bath, drink and wash food such as fruits and vegetables all with the one water supply.These situations increase the exposure of infectious diseases (Gelid, 2005). The global increase of food costs also lead to unhealthy nutritional status. There is evidence to suggest that those with low income can no longer buy quality products eating to household restrictions, affecting the country economy as well (Bloom, Brinkman, De Pee, Sandhog, & Suburban, 2010). As discussed poor countries have a predominance of infectious diseases from reasons such as lack of education or financially unable to afford better-quality health care.These reasons are opposed to the predominance of disease in wealthier countries that have been found to be lifestyle-related based due to personal choice, individual behavior and increased access to fast food, tobacco and alcohol in wealthier countries also increases the chances of these diseases (Cutler & Leers-Money, 2012). Wealthy counties have shown to be dominated by l ifestyle-related diseases and very rarely having outbreaks of infectious diseases (Cutler & Leers-Money, 2012).Health-related behaviors prone to produce lifestyle-related diseases can include the overcompensation of alcohol intake, smoking, unhealthy diet and lack of physical activity (Adam et al. , 2011). By acting upon these behaviors, the individual is exposing themselves to cardiovascular diseases and various types of cancers such as lung and liver, only to has led to a high percentage of skin cancer, as people do not take sun protection into inconsideration when doing so (Turrets et al. , 2006). It is important to note that not only does health inequality exist from country to country, but within country ethnicity groups as well (Healed, 2004).Health inequality within Australia is evident with Indigenous Australians who have shown a lower level of good health and access to appropriate health care treatment than non-indigenous Australians (Healed, 2004). Step Five: To sum up, th is essay has provided me with the graduate attribute of thinking critically and reflectively. It is essential for all students to develop this particular skill, to only for university purposes but also to use throughout their future careers. This essay has allowed me to reflect on past experiences and evaluate health inequality between wealthy and poor countries.From this, I was able to think critically for reasons on this such as economy and educational level found within undeveloped countries and lifestyle choices within wealthier countries. Developing this skill has made me conclude that health inequality does not only exist within a country as a whole, but can occur within country regions as well. Additionally, I was able to not only reflect and think about my own perspective based n my living conditions, but the need to step outside of one's shoes to see how others in undeveloped countries experience health inequality.

The Argument About Cxc Essay Topics

The Argument About Cxc Essay Topics Cxc Essay Topics - the Conspiracy Training to compose essays on various topics is going to be the very best preparation to the exam. Recent events are frequently the topic of argumentative topics for college students. The topic also needs to be the one which provides the students sufficient to write on. Research-based topics require students to collect information till they write. Enable the professional academic writers help to your informative paper! The real leadership essay is simple to read and understand. Also, on account of the advancement in medicine, doctors have the ability to tell whether a kid would be born with a chronic disease. The attractiveness of Shakespearean works is that each one of them conveys an exceptional social message that is true even today. Teens need to be able to pick their bedtime. Children watch an excessive amount of television. Top Choices of Cxc Essay Topics The topics for argumentative essays are often quite self-explanatory they're common understanding. You might be offered a list of essay prompts to select from. Such essays shall have a good deal of quotations, based just on facts and laws, and show no more than the true picture of the circumstance. To discover argumentative essay topics easy on various platforms, you want to comprehend about the argumentative essay. Don't neglect to bring a strong hook at the beginning (introduction paragraph) and wind up with an impressive conclusion to create the reader want to talk about the interesting persuasive essay topics of your pick. It's needless to say that you should go for a subject that you regard as interesting. When you select the right topic you shall ensure it is attractive to the reader. Don't forget the kind of the question you're answering and don't begin introducing new topics merely to pad out your answer. Argumentative essay topics are so important since they are debatableand it's vital to at all times be critically considering the world around us. Argumentative essay topics cover a wide selection of subjects, and can be quite persuasive if a high quality essay represents them. Recent argumentative essay topics that are related to society is going to do. There are a few great topics to look at when deciding on a topic for your argumentative essay. There are lots of aspects about a sport that may be argued in an essay. There are a few thumb rules for argumentative essay subjects to prevent clashes, yet earning a point at the exact same moment. There are several interesting and challenging Shakespeare essay topics to pick from. On the opposite side, obtaining a list of good persuasive essay topics is insufficient. Vital Pieces of Cxc Essay Topics Year round school isn't a good idea. You can't write as you want. Yearly driving tests ought to be mandatory over a specific age. Valentine's Day isn't a holiday. Most Noticeable Cxc Essay Topics Select the period of life that you believe is best and compose an essay arguing why it's the ideal time of life. Our life is about words. Every one of the ideas above will provide you with a chance to reveal your creative side and capacity to talk about your opinion. Some of the absolute most essential things in life may not be purchased with money, for example, friendship, love, knowledge, honestly, spirituality. Writing prompts are among the best methods to create confident writers who take pleasure in the procedure. Deciding on your topic isn't that easy. Showing awareness about recent changes in this issue you're writing on is very crucial to win a very good grade.

Coca Cola Comprehensive Marketing Plan Essay - 937 Words

Running head: COCA-COLA COMPREHENSIVE MARKETING PLAN 1 COCA-COLA COMPREHENSIVE MARKETING PLAN 2 Coca-Cola Comprehensive Marketing Plan Hieu Le Columbia Southern University Coca-Cola Comprehensive Marketing Plan Products promotion contains of multiple works applied to sell goods. There are products promotions that provide customers to purchase products within a short period of time with a pricing discount. Additionally, product promotions are the competitive features to make a difference in pricing in order to motivate consumers recognize the company?s products and purchase it with a special incentive. Likewise, products promotions are often offer in short-term programs that demand involved party on the section of the customer through direct purchase or other transaction. The principal objective of the products promotions to provide a company increases its market share, to reduce unwanted inventories, and generate additional sales. Products promotions consist different methods, which include advertising, publicity, and public relation. Promotion Competitive Advantage Analysis Advertising Advertising is a such paid formation without personal presentation to promote particular product or service within a certain social media (Radio, TV, magazine, and so forth). Likewise, advertising is an effective way to inform customers geographically broadcasted with a comparatively minimal expense (Perreault, Cannon McCarthy, 2015). An excellenceShow MoreRelatedCoca Cola Comprehensive Marketing Plan930 Words   |  4 PagesRunning head: COCA-COLA COMPREHENSIVE MARKETING PLAN 1 COCA-COLA COMPREHENSIVE MARKETING PLAN 2 Coca-Cola Comprehensive Marketing Plan Hieu Le Columbia Southern University Coca-Cola Comprehensive Marketing Plan Industry Analysis Coca- Cola is a world largest soft drinks company, which holds approximate 62 percent of the market share. The firm owns most popular brands like Coke, Sprite, Dr. Pepper, and Fants. Additionally, Coca-Cola has added other exotic brands include Powerade and DasaniRead MoreCoca Cola Comprehensive Marketing Plan1134 Words   |  5 PagesRunning head: COCA-COLA COMPREHENSIVE MARKETING PLAN 1 COCA-COLA COMPREHENSIVE MARKETING PLAN 5 Coca-Cola Comprehensive Marketing Plan Hieu Le Columbia Southern University Coca-Cola Comprehensive Marketing Plan Product pricing is the primary justification for value from a customer?s perspective (Perreault, Cannon McCarthy, 2015). Majority times consumers lack a knowledge of the total cost of product that launching into the market. However, those customers may understandRead MoreMarketing Communications Mix1739 Words   |  7 PagesIntroduction The purpose of this essay is to look at the Marketing Communications Mix, clearly define the meaning of each type and show how Coca Cola, one of the biggest brands on the global market, utilises each method. Belch, E. and Belch A. describe Integrated Marketing Communications as â€Å"a concept of marketing communications planning that recognizes the added value of a comprehensive plan that evaluates the strategic roles of a variety of communication disciplines and combines these disciplinesRead MoreMarketing Mix Analysis Of Coke Zero1212 Words   |  5 Pages Marketing Mix Analysis Student’s Name Institution Affiliation / Marketing Mix Analysis The marketing mix encompasses four critical decisions regarding pricing, product, place, and promotion which should be carefully considered prior to launching the product in the market. All the four variables included in the marketing mix are important as they help the organization to formulate strategic decisions that are essential to obtain and sustain a competitive edge (Singh, 2012). AfterRead MoreThe Principles Of Global Marketing1632 Words   |  7 PagesThe principles of global marketing Introduction Global marketing, which is a theory about the worldwide merchandising strategy, establishes the basement of marketing. As globalization is combined with diverse cultures from the whole world, costumers have different demands which have to achieve by businesses. In addition, the strategy of global marketing is necessary for companies to develop new markets. This assignment will firstly explain what global marketing is. After that, it will confer strategyRead MoreCoca Cola And The World Fight Against Hiv / Aids1416 Words   |  6 Pagesvalue of $25 billion, the Coca-Cola brand is globally synonymous with soft drink beverages, and holds the title of the world s largest beverage company. So large in fact, that they have maintained as much as 50% of the world s market, they operate in excess of 200 countries across the globe, 85% of their revenue stems in the international market, they facilitate the world s largest distribution system, and produce four of the top five soft drinks in the world. Coca-Cola is a large supporter of philanthropicRead MoreComparative Human Resource Analysis : Coca Cola And Pepsico1465 Words   |  6 PagesAnalysis: Coca-Cola and PepsiCo. Abhiram Satyadev Goldey Beacom College Course Name 02/16/2017 Table of Contents 1. Competition for Employees†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦..†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.3 2. Compensation of Employees†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦..4 3. Legislation Concerning Employees.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦...5 4. Human Relations Discussion†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦..6 5. Conclusions†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦7 6. References†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦8 Comparative Human Resource Analysis: Coca-Cola v/sRead MoreMK0272 Essay3670 Words   |  15 Pages MODULE TITLE: MARKETING PLANNING AND RESEARCH MODULE CODE: MK0272 STUDENT NAME: LU XUELU STUDENT NUMBER: 13039825 HAND IN DATE: 01.07.2014 TUTOR: ANDERS WAPPLING WORLDS: 1.0 Executive summary†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦. 2 2.0 External environment analysis†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦2 3.0 Market strategy†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.....5 4.0 Marketing research result †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.....6 5.0 Marketing mix summary†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦...9 6.0 andRead MoreBtec Business P4- Strategic Planning1220 Words   |  5 Pagesfocus of a strategic plan is usually on the entire organization, while the focus of a business plan is usually on a particular product, service or program. There are a variety of perspectives, models and approaches used in strategic planning. The way that a strategic plan is developed depends on the nature of the organizations leadership, culture of the organization, complexity of the organizations environment, size of the organization and expertise of planners. Coca-Cola Company My organisationRead MoreMarketing Strategy Of Coca Cola1751 Words   |  8 Pages(Masters in Business Administration) under Westcliff University. The students are assigned to submit Comprehensive Learning Assessment of marketing on a product or service. This assignment has been prepared with a different idea in mind. This assignment contains a brief introduction of a product Coca Cola. Also, I have performed an environmental analysis, industry analysis, SWOT analysis and marketing mix analysis in order to identify the potential areas of growth and areas where more attention is required